LIVE Course for free

Rated by 1 million+ students
Get app now
0 votes
65 views
in Biology by (52.3k points)
closed by

A template strand is given below. Write down the corresponding coding strand and the mRNA strand that can be formed, along with their polarity.

3′ ATGCATGCATGCATGCATGCATGC 5′

1 Answer

+1 vote
by (56.7k points)
selected by
 
Best answer

Coding strand: 5′ TACGTACGTACGTACGTACGTACG 3′ mRNA strand: 5′ UACGUACGUACGUACGUACGUACG 3′

Welcome to Sarthaks eConnect: A unique platform where students can interact with teachers/experts/students to get solutions to their queries. Students (upto class 10+2) preparing for All Government Exams, CBSE Board Exam, ICSE Board Exam, State Board Exam, JEE (Mains+Advance) and NEET can ask questions from any subject and get quick answers by subject teachers/ experts/mentors/students.

Categories

...