Fewpal
0 votes
284 views
in Biology by (127k points)
If the sequence of one strand of DNA is written as follows:
5'-ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of complementary strand in 5'→3' direction

1 Answer

+1 vote
by (94.8k points)
selected by
 
Best answer

The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is
5'- ATGCATGCATGCATGCATGCATGCATGC − 3’
Then, the sequence of complementary strand in 5' to 3' direction will be
3'- TACGTACGTACGTACGTACGTACGTACG − 5’
Therefore, the sequence of nucleotides on DNA polypeptide in 5' to 3' direction is
5'- GCATGCATGCATGCATGCATGCATGCAT− 3’

Welcome to Sarthaks eConnect: A unique platform where students can interact with teachers/experts/students to get solutions to their queries. Students (upto class 10+2) preparing for All Government Exams, CBSE Board Exam, ICSE Board Exam, State Board Exam, JEE (Mains+Advance) and NEET can ask questions from any subject and get quick answers by subject teachers/ experts/mentors/students.

Categories

...