LIVE Course for free

Rated by 1 million+ students
Get app now
0 votes
44.8k views
in Biology by (30.9k points)

A template strand is given below. Write down the corresponding coding strand and the mRNA strand that can be formed along with their polarity. 

3' ATGCATGCATGCATGCATGCATGC 5' 

1 Answer

+1 vote
by (60.9k points)
selected by
 
Best answer

Coding strand - 5'

TACGTACGTACGTACGTACGTACG 3'

mRNA stands - 5'

UACGUACGUACGUACGUACGUACG 3'.

Welcome to Sarthaks eConnect: A unique platform where students can interact with teachers/experts/students to get solutions to their queries. Students (upto class 10+2) preparing for All Government Exams, CBSE Board Exam, ICSE Board Exam, State Board Exam, JEE (Mains+Advance) and NEET can ask questions from any subject and get quick answers by subject teachers/ experts/mentors/students.

Categories

...