(i) How many molecules of DNA will be generated after four cycles of PCR?

Question

Polymerase Chain Reaction is an important tool to amplify rapidly a small sample of DNA to generate millions of copies because significant amounts are necessary for molecular and genetic analysis. Once amplified, the DNA produced by PCR can be used in many different laboratory procedures. A scientist deposited hundred double stranded molecules with the following sequence for multiplication by PCR to Pennysylvania Molecular Biology Lab. The sequence consist of coding region from nucleotide position 11 to 40.

5’CAGTTCATGTCAAATTGCGAGTCTCGCAAAGGCTGGACTTAATCGA3’

(i) How many molecules of DNA will be generated after four cycles of PCR?

(ii) Which strand will act as template in this reaction?

(iii) Design two primers that are five nucleotides long to specifically allow amplification of the coding area from the given sequence.

OR

(iii) Explain how PCR can help with solving disputed paternity claims.

Answer 1

(i) 16 DNA molecules would be generated after 4 cycles.

(ii) Both the strands will act as the template in this case.

(iii) 5’ CTGAA 3’ and 5’ CAATT 3’

OR

(iii) PCR can amplify the genome sequence from parents and offspring and DNA fingerprinting can match the pattern obtained.